peMBD2G (pc2399)
(Plasmid #211572)

• Purpose: Expresses fl. MBD2 GFP tagged in mammalian cells
• Depositing Lab: Cristina Cardoso
• Publication: Becker et al PLoS One. 2013;8(1):e53730. doi: 10.1371/journal.pone.0053730. Epub 2013 Jan 15.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech Vector
• Total vector size (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MBD2
• Alt name: Mus musculus methyl-CpG binding domain protein 2
• Species: M. musculus (mouse)
• Insert Size (bp): 1971
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GGTGCAGATGAACTTCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry