pLEW-pHluorin2-PTS1
(Plasmid #213776)

• Purpose: Expresses the fluorescent protein pH sensor pHlorin2 in the glycosomes of Trypanosomal brucei
• Depositing Lab: Kenneth Christensen
• Publication: Measuring Dynamic Glycosomal pH Changes in Living Trypanosoma brucei (unpublished)

Backbone

• Vector backbone: pLEW100v5
• Backbone size w/o insert (bp): 5560
• Total vector size (bp): 6292
• Vector type: Trypanosoma brucei expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pHlorin2
• Species: Synthetic
• Insert Size (bp): 732
• Mutation: Appended a 2 glycine linker and a T. brucei peroxisome targeting sequence (AKL) at the C-terminus of pHlorin2
• Promoter: T. brucei rRNA promotor

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CCCTATAGTGAGTCGTATTA
• 3′ sequencing primer: GATTTAGGTGACACTATAG

Resource Information

• Supplemental Documents:
  • pLEW-pHlorin2-PTS1.gbk
• A portion of this plasmid was derived from a plasmid made by: Synthesized from published AA sequence (https://doi.org/10.4236%2Fabb.2011.23021) at Twist Bioscience

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry