-
PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomerase
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213827 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcW57.1
- Backbone size w/o insert (bp) 7705
- Total vector size (bp) 11104
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin, HIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman TERT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3399
-
Entrez GeneTERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
- Promoter Tet-responsive promoter PTight, consisting of seven tet operator sequences followed by the minimal CMV promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGTGCCTGGTGTGCGTG
- 3′ sequencing primer CTCCCTGACGCTATGGTTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TERT - WT was a gift from Coleman Lindsley (Addgene plasmid # 213827 ; http://n2t.net/addgene:213827 ; RRID:Addgene_213827) -
For your References section:
The clinical and functional effects of TERT variants in myelodysplastic syndrome. Reilly CR, Myllymaki M, Redd R, Padmanaban S, Karunakaran D, Tesmer V, Tsai FD, Gibson CJ, Rana HQ, Zhong L, Saber W, Spellman SR, Hu ZH, Orr EH, Chen MM, De Vivo I, DeAngelo DJ, Cutler C, Antin JH, Neuberg D, Garber JE, Nandakumar J, Agarwal S, Lindsley RC. Blood. 2021 Sep 9;138(10):898-911. doi: 10.1182/blood.2021011075. 10.1182/blood.2021011075 PubMed 34019641