Skip to main content

KIF5A-GFP-SspB
(Plasmid #214401)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214401 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 214401-D50 50 μg of DNA in Tris buffer $495
DNA 214401-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFPN1
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6790
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    KIF5A-GFP-SspB
  • Alt name
    Kif5a
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    2844
  • Entrez Gene
    Kif5a
  • Promoter CMV
  • Tag / Fusion Protein
    • KIF5A-GFP-SspB (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KIF5A-GFP-SspB was a gift from Liting Duan (Addgene plasmid # 214401 ; http://n2t.net/addgene:214401 ; RRID:Addgene_214401)
  • For your References section:

    Force-induced tail-autotomy mitochondrial fission and biogenesis of matrix-excluded mitochondrial-derived vesicles for quality control. Liu X, Xu L, Song Y, Zhao Z, Li X, Wong CY, Chen R, Feng J, Gou Y, Qi Y, Chow HM, Yao S, Wang Y, Gao S, Liu X, Duan L. Proc Natl Acad Sci U S A. 2024 Apr 2;121(14):e2217019121. doi: 10.1073/pnas.2217019121. Epub 2024 Mar 28. 10.1073/pnas.2217019121 PubMed 38547062