KIF5A-GFP-SspB
(Plasmid
#214401)
-
PurposeExpresses fusion of Kinesin heavy chain 5A (1-572) with GFP and SspB (micro)
-
Depositing Lab
-
Depositing OrganizationChinese University of Hong Kong
Located in the Hong Kong Special Administrative Region of China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 214401-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 214401-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFPN1
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 6790
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKIF5A-GFP-SspB
-
Alt nameKif5a
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)2844
-
Entrez GeneKif5a
- Promoter CMV
-
Tag
/ Fusion Protein
- KIF5A-GFP-SspB (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CCTCTACAAATGTGGTATGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.27.513965v1 for bioRxiv preprint.
DNA (Catalog # 214401-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 214401-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KIF5A-GFP-SspB was a gift from Liting Duan (Addgene plasmid # 214401 ; http://n2t.net/addgene:214401 ; RRID:Addgene_214401) -
For your References section:
Force-induced tail-autotomy mitochondrial fission and biogenesis of matrix-excluded mitochondrial-derived vesicles for quality control. Liu X, Xu L, Song Y, Zhao Z, Li X, Wong CY, Chen R, Feng J, Gou Y, Qi Y, Chow HM, Yao S, Wang Y, Gao S, Liu X, Duan L. Proc Natl Acad Sci U S A. 2024 Apr 2;121(14):e2217019121. doi: 10.1073/pnas.2217019121. Epub 2024 Mar 28. 10.1073/pnas.2217019121 PubMed 38547062
Map uploaded by the depositor.
