Skip to main content
Addgene
Open Menu

hJAM-A pcDNA3.1
(Plasmid #70073)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70073 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 70073-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 70073-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    junctional adhesion molecule-A
  • Alt name
    JAM-A, JAM1, F11R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1617
  • Entrez Gene
    F11R (a.k.a. CD321, JAM, JAM1, JAMA, JCAM, KAT, PAM-1)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH Reverse: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloned out of an NT2 cDNA library (Stratagene, La Jolla, CA)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hJAM-A pcDNA3.1 was a gift from Terence Dermody (Addgene plasmid # 70073 ; http://n2t.net/addgene:70073 ; RRID:Addgene_70073)

  • For your References section:

    JAM-A-independent, antibody-mediated uptake of reovirus into cells leads to apoptosis. Danthi P, Hansberger MW, Campbell JA, Forrest JC, Dermody TS. J Virol. 2006 Feb;80(3):1261-70. 10.1128/JVI.80.3.1261-1270.2006 PubMed 16415003
Related items:
Commonly requested with: