-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4735
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZonula Occludens-1
-
Alt nameZO-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5675
-
MutationUnique spliceform*
-
Entrez GeneTJP1 (a.k.a. ZO-1)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac I (not destroyed)
- 3′ cloning site Pst I (destroyed during cloning)
- 5′ sequencing primer pEGFP-N (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
From the author: The insert is an alternatively spliced domain (which we have confirmed in several ways) that is common to the prevalent ZO-1 species in most epithelial cells. It is adjacent to the conserved ZU5 domain.
This isoform is not present in all of the cDNAs we have worked with, but we chose to use this isoform for our GFP ZO-1 studies. This is the cDNA and spliceform that I used in all of our studies.
The alt splice is actually 60 bp, and is as follows:
GCGTCCATGACTCCTGACGGTTGGTCTTTTGCTCTAAAATCATCCGACTCCTCGTCGGGT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP ZO1 was a gift from Alan Fanning (Addgene plasmid # 30313 ; http://n2t.net/addgene:30313 ; RRID:Addgene_30313) -
For your References section:
Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1. Fanning AS, Ma TY, Anderson JM. FASEB J. 2002 Nov . 16(13):1835-7. 10.1096/fj.02-0121fje PubMed 12354695