MCAM-BirA*-HA
(Plasmid #214472)

• Purpose: Lentiviral vector for the expression of MCAM-BirA*-HA fusion protein in mammalian cells.
• Depositing Lab: Natalie Ahn
• Publication: Miller et al Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255.

Backbone

• Vector backbone: CSII-Rfa-IRES-Hygro Lentiviral Dest
• Backbone manufacturer: Xuedong Liu, University of Colorado Boulder
• Backbone size w/o insert (bp): 12467
• Total vector size (bp): 13864
• Vector type: Mammalian Expression, Lentiviral ; Gateway
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MCAM
• Alt name: Melanoma Cell Adhesion Molecule
• Alt name: CD146
• Alt name: Muc18
• Species: H. sapiens (human)
• Promoter: EF-1a
• Tags / Fusion Proteins:
  • BirA(R118G) (C terminal on insert)
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: ACTTTGTACAAGAAAGCTGGG

Resource Information

• Supplemental Documents:
  • MCAM-BirA-HA_Sanger-Consensus_3749-6824.gb
  • MCAM-BirA-HA_Predicted.gb
• A portion of this plasmid was derived from a plasmid made by: CCSB-Boad Lentiviral Expression Library plasmid ccsbBroad304_06567, from the Functional Genomics facility, University of Colorado Anschutz Medical Campus, Denver, CO.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Detailed information on cloning, including cloning of entry vector, cloning and internal sequencing primers, and entry vector sequences are available in the supplemental materials for Miller et al. This construct was used for BioID experiments (Roux et al., 2012, J Cell Biol 196, 801-810). The BirA(R118G)-HA tag was PCR amplified from Addgene Plasmid #53581 (a gift from Karl Kramer; http://n2t.net/addgene:53581 ; RRID:Addgene_53581) and inserted into the entry vector.