RDX-mCherry
(Plasmid #214476)

• Purpose: Plasmid for transient transfection of RDX-mCherry fusion protein in mammalian cells.
• Depositing Lab: Natalie Ahn
• Depositing Organization: University of Colorado, Boulder
  Located in the United States of America
• Publication: Miller et al Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255.

Backbone

• Vector backbone: mCherry-Ezrin-N-14
• Backbone manufacturer: Michael Davidson, Addgene Plasmid #55043
• Total vector size (bp): 6439
• Modifications to backbone: Removed ezrin insert and replaced with RDX (radixin) insert.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RDX
• Alt name: radixin
• Species: H. sapiens (human)
• Mutation: Sequence matches cDNA clone MGC:48283 IMAGE:5284438 (GenBank Accession BC047109.1) which differs from the canonical sequence at one amino acid (K328E).
• Entrez Gene: RDX (a.k.a. DFNB24)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CCSB-Boad Lentiviral Expression Library plasmid ccsbBroad304_06855 from the Functional Genomics facility at the University of Colorado Anschutz Medical Campus, Denver, CO.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid was generated by PCR amplifying RDX from the CCSB-Broad Lentiviral Expression Library collection (ccsbBroad304_06855, source clone GenBank accession: BC047109) and inserting it into the mCherry backbone which was PCR amplified from mCherry-Ezrin-N-14, a gift from Michael Davidson (Addgene plasmid # 55043 ; http://n2t.net/addgene:55043 ; RRID:Addgene_55043). RDX was inserted into the backbone using the FastCloning method (Li et al., 2011, BMC Biotechnol 11, 92). The primer sequences for FastCloning and internal sequencing primers are included in the supplemental material for Miller et al.

DNA (Catalog # 214476-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 214476-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.