PGL3-MK17
(Plasmid
#21486)
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in the United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 21486-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 21486-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePGL3 Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4800
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCited2 Promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3440
-
GenBank IDAF129290
-
Entrez GeneCITED2 (a.k.a. ASD8, MRG-1, MRG1, P35SRJ, VSD2)
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site kpnI (not destroyed)
- 3′ cloning site xhoI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid
DNA (Catalog # 21486-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 21486-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-MK17 was a gift from Shoumo Bhattacharya (Addgene plasmid # 21486 ; http://n2t.net/addgene:21486 ; RRID:Addgene_21486) -
For your References section:
Molecular cloning and chromosomal localization of the human CITED2 gene encoding p35srj/Mrg1. Leung MK, Jones T, Michels CL, Livingston DM, Bhattacharya S. Genomics. 1999 Nov 1. 61(3):307-13. 10.1006/geno.1999.5970 PubMed 10552932
Map uploaded by the depositor.