Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73955)


Item Catalog # Description Quantity Price (USD)
Plasmid 73955 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 7900
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    NLR family, pyrin domain containing 3 (NLRP3)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
  • Promoter CMV iE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site Sal1 (destroyed during cloning)
  • 5′ sequencing primer EGFP-C Sequencing Primer (GGTCCTTCTTGAGTTTGTAAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C2-NLRP3 was a gift from Christian Stehlik (Addgene plasmid # 73955 ; ; RRID:Addgene_73955)
  • For your References section:

    An NLRP7-containing inflammasome mediates recognition of microbial lipopeptides in human macrophages. Khare S, Dorfleutner A, Bryan NB, Yun C, Radian AD, de Almeida L, Rojanasakul Y, Stehlik C. Immunity. 2012 Mar 23;36(3):464-76. doi: 10.1016/j.immuni.2012.02.001. Epub 2012 Feb 21. 10.1016/j.immuni.2012.02.001 PubMed 22361007