pLEX-MCS-ASC-GFP
(Plasmid #73957)

• Purpose: Express human ASC with a C-terminal EGFP tag in mammalian cells
• Depositing Lab: Christian Stehlik
• Publication: de Almeida et al Immunity. 2015 Aug 18;43(2):264-76. doi: 10.1016/j.immuni.2015.07.018. Epub 2015 Aug 11.

Backbone

• Vector backbone: pLEX-Myc
• Backbone size w/o insert (bp): 11088
• Total vector size (bp): 13200
• Modifications to backbone: A MCS was inserted into the BamHI and XhoI sites (the BamH1 site was destroyed) as indicated in the attached map
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PYD and CARD domain containing, PYCARD
• Alt name: ASC
• Alt name: TMS-1
• Species: H. sapiens (human)
• Insert Size (bp): 2000
• GenBank ID: NM_013258.4
• Entrez Gene: PYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
• Promoter: CMV IE
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Spe1 (destroyed during cloning)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: CMV iE FwD (CGCAAATGGGCGGTAGGCGTG)

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry