-
PurposeExpress human ASC with a C-terminal EGFP tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLEX-Myc
- Backbone size w/o insert (bp) 11088
- Total vector size (bp) 13200
-
Modifications to backboneA MCS was inserted into the BamHI and XhoI sites (the BamH1 site was destroyed) as indicated in the attached map
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePYD and CARD domain containing, PYCARD
-
Alt nameASC
-
Alt nameTMS-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
GenBank IDNM_013258.4
-
Entrez GenePYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Spe1 (destroyed during cloning)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CMV iE FwD (CGCAAATGGGCGGTAGGCGTG) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX-MCS-ASC-GFP was a gift from Christian Stehlik (Addgene plasmid # 73957 ; http://n2t.net/addgene:73957 ; RRID:Addgene_73957) -
For your References section:
The PYRIN Domain-only Protein POP1 Inhibits Inflammasome Assembly and Ameliorates Inflammatory Disease. de Almeida L, Khare S, Misharin AV, Patel R, Ratsimandresy RA, Wallin MC, Perlman H, Greaves DR, Hoffman HM, Dorfleutner A, Stehlik C. Immunity. 2015 Aug 18;43(2):264-76. doi: 10.1016/j.immuni.2015.07.018. Epub 2015 Aug 11. 10.1016/j.immuni.2015.07.018 PubMed 26275995