Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCI-Caspase 1
(Plasmid #41552)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41552 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4006
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Caspase-1
  • Alt name
    CASP1
  • Alt name
    ICE
  • Alt name
    CASP1 caspase 1, apoptosis-related cysteine peptidase
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_033292.3 NP_150634.1
  • Entrez Gene
    CASP1 (a.k.a. ICE, IL1BC, P45)
  • Promoter CMV immediate-early enhancer/promoter
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer chim-int-F (TCTTACTGACATCCACTTTGCC)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-Caspase 1 was a gift from Kate Fitzgerald (Addgene plasmid # 41552 ; http://n2t.net/addgene:41552 ; RRID:Addgene_41552)
  • For your References section:

    AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC. Hornung V, Ablasser A, Charrel-Dennis M, Bauernfeind F, Horvath G, Caffrey DR, Latz E, Fitzgerald KA. Nature. 2009 Mar 26. 458(7237):514-8. 10.1038/nature07725 PubMed 19158675