Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCI-Caspase 1
(Plasmid #41552)


Item Catalog # Description Quantity Price (USD)
Plasmid 41552 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4006
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
    CASP1 caspase 1, apoptosis-related cysteine peptidase
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_033292.3 NP_150634.1
  • Entrez Gene
    CASP1 (a.k.a. ICE, IL1BC, P45)
  • Promoter CMV immediate-early enhancer/promoter
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer chim-int-F (TCTTACTGACATCCACTTTGCC)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-Caspase 1 was a gift from Kate Fitzgerald (Addgene plasmid # 41552 ; ; RRID:Addgene_41552)
  • For your References section:

    AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC. Hornung V, Ablasser A, Charrel-Dennis M, Bauernfeind F, Horvath G, Caffrey DR, Latz E, Fitzgerald KA. Nature. 2009 Mar 26. 458(7237):514-8. 10.1038/nature07725 PubMed 19158675