Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3-Myc-ASC
(Plasmid #73952)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73952 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5459
  • Total vector size (bp) 6100
  • Modifications to backbone
    A c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PYD and CARD domain containing, PYCARD
  • Alt name
    ASC
  • Alt name
    TMS-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    636
  • GenBank ID
    NM_013258.4
  • Entrez Gene
    PYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
  • Promoter CMV
  • Tag / Fusion Protein
    • c-myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
  • 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Myc-ASC was a gift from Christian Stehlik (Addgene plasmid # 73952 ; http://n2t.net/addgene:73952 ; RRID:Addgene_73952)
  • For your References section:

    Activation of inflammasomes requires intracellular redistribution of the apoptotic speck-like protein containing a caspase recruitment domain. Bryan NB, Dorfleutner A, Rojanasakul Y, Stehlik C. J Immunol. 2009 Mar 1;182(5):3173-82. doi: 10.4049/jimmunol.0802367. 10.4049/jimmunol.0802367 PubMed 19234215