-
PurposeExpress c-Myc-tagged human ASC in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73952-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73952-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5459
- Total vector size (bp) 6100
-
Modifications to backboneA c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePYD and CARD domain containing, PYCARD
-
Alt nameASC
-
Alt nameTMS-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)636
-
GenBank IDNM_013258.4
-
Entrez GenePYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
- Promoter CMV
-
Tag
/ Fusion Protein
- c-myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
- 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73952-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73952-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Myc-ASC was a gift from Christian Stehlik (Addgene plasmid # 73952 ; http://n2t.net/addgene:73952 ; RRID:Addgene_73952) -
For your References section:
Activation of inflammasomes requires intracellular redistribution of the apoptotic speck-like protein containing a caspase recruitment domain. Bryan NB, Dorfleutner A, Rojanasakul Y, Stehlik C. J Immunol. 2009 Mar 1;182(5):3173-82. doi: 10.4049/jimmunol.0802367. 10.4049/jimmunol.0802367 PubMed 19234215