-
PurposeExpress c-Myc-tagged human NLRP3(R260W) in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5459
- Total vector size (bp) 8700
-
Modifications to backboneA c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLR family, pyrin domain containing 3 (NLRP3)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3200
-
MutationR260W
-
GenBank IDNM_004895.4
-
Entrez GeneNLRP3 (a.k.a. AGTAVPRL, AII, AVP, C1orf7, CIAS1, CLR1.1, DFNA34, FCAS, FCAS1, FCU, KEFH, MWS, NALP3, PYPAF1)
- Promoter CMV iE
-
Tag
/ Fusion Protein
- c-myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site XhoI1 (not destroyed)
- 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
- 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Myc-NLRP3(R260W) was a gift from Christian Stehlik (Addgene plasmid # 73956 ; http://n2t.net/addgene:73956 ; RRID:Addgene_73956) -
For your References section:
Cellular pyrin domain-only protein 2 is a candidate regulator of inflammasome activation. Dorfleutner A, Bryan NB, Talbott SJ, Funya KN, Rellick SL, Reed JC, Shi X, Rojanasakul Y, Flynn DC, Stehlik C. Infect Immun. 2007 Mar;75(3):1484-92. Epub 2006 Dec 18. 10.1128/IAI.01315-06 PubMed 17178784
Map uploaded by the depositor.
Map uploaded by the depositor.