-
PurposeExpress c-Myc-tagged human NLRP3(R260W) in mammalian cells
-
Depositing Lab
-
Depositing OrganizationWest Virginia University and School of Medicine
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73956-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73956-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5459
- Total vector size (bp) 8700
-
Modifications to backboneA c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLR family, pyrin domain containing 3 (NLRP3)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3200
-
MutationR260W
-
GenBank IDNM_004895.4
-
Entrez GeneNLRP3 (a.k.a. AGTAVPRL, AII, AVP, C1orf7, CIAS1, CLR1.1, DFNA34, FCAS, FCAS1, FCU, KEFH, MWS, NALP3, PYPAF1)
- Promoter CMV iE
-
Tag
/ Fusion Protein
- c-myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site XhoI1 (not destroyed)
- 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
- 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73956-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73956-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Myc-NLRP3(R260W) was a gift from Christian Stehlik (Addgene plasmid # 73956 ; http://n2t.net/addgene:73956 ; RRID:Addgene_73956) -
For your References section:
Cellular pyrin domain-only protein 2 is a candidate regulator of inflammasome activation. Dorfleutner A, Bryan NB, Talbott SJ, Funya KN, Rellick SL, Reed JC, Shi X, Rojanasakul Y, Flynn DC, Stehlik C. Infect Immun. 2007 Mar;75(3):1484-92. Epub 2006 Dec 18. 10.1128/IAI.01315-06 PubMed 17178784
Map uploaded by the depositor.
Map uploaded by the depositor.