Skip to main content
Addgene
Open Menu

Px330-EGFP-DJ1 X1-5DEL gRNA (1)-CRISPR_Cas9
(Plasmid #214929)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214929 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pX330-EGFP
  • Backbone manufacturer
    Jaenisch Laboratory, Soldner et al. Nature (2016) vol 533, pg 95-99
  • Backbone size w/o insert (bp) 10157
  • Total vector size (bp) 10178
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5' gRNA to target Exon 1-5 of DJ-1 (dual guide approach)
  • Alt name
    PARK7; DJ1; GATD2; HEL-S-67p
  • gRNA/shRNA sequence
    gaacactgatgtatttaggcc
  • Species
    H. sapiens (human)
  • Entrez Gene
    PARK7 (a.k.a. DJ-1, DJ1, GATD2, HEL-S-67p)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Px330-EGFP-DJ1 X1-5DEL gRNA (1)-CRISPR_Cas9 was a gift from Frank Soldner (Addgene plasmid # 214929 ; http://n2t.net/addgene:214929 ; RRID:Addgene_214929)

  • For your References section:

    iSCORE-PD: an isogenic stem cell collection to research Parkinson's disease. Busquets O, Li H, Syed KM, Jerez PA, Dunnack J, Lo Bu R, Verma Y, Pangilinan GR, Martin A, Straub J, Du Y, Simon VM, Poser S, Bush Z, Diaz J, Sahagun A, Gao J, Hong S, Hernandez DG, Levine KS, Pochet N, Booth EO, Blanchette M, Bateup HS, Rio DC, Blauwendraat C, Hockemeyer D, Soldner F. Nat Commun. 2026 Jun 17;17(1):7682. doi: 10.1038/s41467-026-74355-8. 10.1038/s41467-026-74355-8 PubMed 42310027
Related items: