TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone
(Plasmid #216152)

• Purpose: Expresses mScarlet in cells with TDP-43 loss-of-function. This plasmid has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells. It uses a cryptic exon. [Code 'A11'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor Comments
• Depositing Lab: Pietro Fratta
• Depositing Organization: Francis Crick Institute
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Wilkins et al Science. 2024 Oct 4;386(6717):61-69. doi: 10.1126/science.adk2539. Epub 2024 Oct 3.

Backbone

• Vector backbone: pTwist CMV
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: MUST use stable bacterial line to avoid recombination of UG-rich region (e.g. Stbl3, NEB Stable)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mScarlet with cryptic exon and C-terminal FLAG
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTCTTGGTGCCAGCTTATCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.11.15.565967 for bioRxiv preprint.

Note: Due to the splicing of lentiviral RNAs prior to viral packaging, which may remove the alternatively-spliced regions of the TDP-REG sequences, we recommend using alternative systems that do not require a transcribed intermediate (transient transfection, AAV, piggybac or other DNA integrases or recombinases).

One approach described in the literature is to use reverse-complemented splicing minigene sequences in lentiviruses, preventing splicing before packaging (e.g. DOI: 10.1038/s41587-022-01224-2). However, this may cause additional issues, such as lowered titres (due to competing promoters on the reverse strand) or the pre-packaging splicing of unannotated splice sites that occur by random chance in the reverse complement sequence (we have observed this phenomenon via Nanopore sequencing of lentiviral RNA). As such, we are also hesitant to recommend this approach.

DNA (Catalog # 216152-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 216152-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.