p2707-pHAGE-Ef1aL-dsRed-UBC-tagBFP
(Plasmid #216476)

• Purpose: lentiviral dual expression of dsRed and tagBFP
• Depositing Lab: Darrell Kotton
• Publication: Burgess et al Cell Stem Cell. 2024 Apr 15:S1934-5909(24)00098-5. doi: 10.1016/j.stem.2024.03.017.

Backbone

• Vector backbone: pHAGE
• Backbone manufacturer: Darrell Kotton
• Total vector size (bp): 8839
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dsRed
• Species: Discosoma coral
• Insert Size (bp): 679
• Promoter: EF1aL

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: n/a
• 3′ sequencing primer: n/a

Gene/Insert 2

• Gene/Insert name: tagBFP
• Species: Synthetic
• Insert Size (bp): 702
• Promoter: UBC

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: acgaatccatatggccatgagcgagctgattaagg
• 3′ sequencing primer: ttcaatcgatatcctttaattaagcttgtgccccag

Resource Information

• Supplemental Documents:
  • p2707-pHAGE EF1aL-DsRed-UBC-tagBFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.01.19.524655v1 for bioRxiv preprint.