T7_CC_PEmax_IVT_Template
(Plasmid
#216793)
-
PurposeTemplate for in vitro transcription of PEmax.
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 216793-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 216793-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBR322
- Total vector size (bp) 10184
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePEmax
-
Insert Size (bp)6396
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector should be linearized with BbsI prior to in vitro transcription. The vector has been designed for co-transcriptional capping with CleanCap AG. The vector encodes for a T7 promoter, a minimal 5’-UTR, a PEmax cassette harboring a silent mutation disrupting a restriction site for the linearizing BbsI enzyme, a 2x HBB 3’ UTR, and a poly(A) sequence. The poly(A) tail is 80-90 nucleotides long, as determined by restriction digestion. Poly(A) tail length should be assessed via restriction digestion after each step of transformation or cloning to avoid Poly(A) tail shortening.
DNA (Catalog # 216793-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 216793-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7_CC_PEmax_IVT_Template was a gift from Daniel Bauer (Addgene plasmid # 216793 ; http://n2t.net/addgene:216793 ; RRID:Addgene_216793) -
For your References section:
Enhancing prime editing in hematopoietic stem and progenitor cells by modulating nucleotide metabolism. Levesque S, Cosentino A, Verma A, Genovese P, Bauer DE. Nat Biotechnol. 2024 May 28. doi: 10.1038/s41587-024-02266-4. 10.1038/s41587-024-02266-4 PubMed 38806736
