PX459-TP53-exon4
(Plasmid
#217455)
-
PurposeFor TP53 knockout targeting exon 4 of TP53
-
Depositing Lab
-
Depositing OrganizationFrancis Crick Institute
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 217455-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 217455-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPR Cas9 guide for TP53
-
gRNA/shRNA sequenceCCATTGTTCAATATCGTCCG
-
SpeciesH. sapiens (human)
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector pSpCas9(BB)-2A-Puro (PX459) V2.0 is from Addgene Cat Num: 62988, Zhang Lab
DNA (Catalog # 217455-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 217455-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459-TP53-exon4 was a gift from John Diffley (Addgene plasmid # 217455 ; http://n2t.net/addgene:217455 ; RRID:Addgene_217455) -
For your References section:
Cyclin E-induced replicative stress drives p53-dependent whole-genome duplication. Zeng J, Hills SA, Ozono E, Diffley JFX. Cell. 2023 Feb 2;186(3):528-542.e14. doi: 10.1016/j.cell.2022.12.036. Epub 2023 Jan 20. 10.1016/j.cell.2022.12.036 PubMed 36681079