Skip to main content

PX459-CDKN1A
(Plasmid #217457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217457 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 217457-D50 50 μg of DNA in Tris buffer $495
DNA 217457-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPR Cas9 guide for CDKN1A
  • gRNA/shRNA sequence
    CCATTAGCGCATCACAGTCG
  • Species
    H. sapiens (human)
  • GenBank ID
    ENSG00000124762
  • Entrez Gene
    CDKN1A (a.k.a. CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector pSpCas9(BB)-2A-Puro (PX459) V2.0 is from Addgene Cat Num: 62988, Zhang Lab

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459-CDKN1A was a gift from John Diffley (Addgene plasmid # 217457 ; http://n2t.net/addgene:217457 ; RRID:Addgene_217457)
  • For your References section:

    Cyclin E-induced replicative stress drives p53-dependent whole-genome duplication. Zeng J, Hills SA, Ozono E, Diffley JFX. Cell. 2023 Feb 2;186(3):528-542.e14. doi: 10.1016/j.cell.2022.12.036. Epub 2023 Jan 20. 10.1016/j.cell.2022.12.036 PubMed 36681079