pSCL758
(Plasmid
#219504)
-
PurposeExpress Eco3RT from a CAG promoter; also express an msr and HEK3, FANCF and EMX1 retron msd donor-gRNAs from a single H1 promoter, separated by tRNA-Cys-GCA sequences
-
Depositing Lab
-
Depositing OrganizationJ. David Gladstone Institutes
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 219504-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 219504-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerBCCM
- Total vector size (bp) 4801
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemsr and HEK3, FANCF and EMX1 retron msd donor-gRNAs from a single H1 promoter, separated by tRNA-Cys-GCA sequences
-
SpeciesSynthetic
-
Insert Size (bp)117
- Promoter H1
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GAAATGTCTTTGGATTTGGGAATCTTATAAGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUsed Addgene items #114454 (pZS157) and #41583 (pCAGGS-mCherry).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.17.549397v1 for bioRxiv preprint.
DNA (Catalog # 219504-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 219504-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCL758 was a gift from Seth Shipman (Addgene plasmid # 219504 ; http://n2t.net/addgene:219504 ; RRID:Addgene_219504) -
For your References section:
Simultaneous multi-site editing of individual genomes using retron arrays. Gonzalez-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Nat Chem Biol. 2024 Nov;20(11):1482-1492. doi: 10.1038/s41589-024-01665-7. Epub 2024 Jul 9. 10.1038/s41589-024-01665-7 PubMed 38982310
