pECFP_C1_NSD2 FL
(Plasmid
#221382)
-
PurposeExpresses NSD2 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversitaet Stuttgart
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221382 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 221382-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 221382-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepECFP-C1
- Backbone size w/o insert (bp) 4734
- Total vector size (bp) 8829
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHistone-lysine N-methyltransferase NSD2
-
Alt nameNSD2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4095
-
MutationL237R mutation in ECFP (Please see depositor comments)
-
Entrez GeneNSD2 (a.k.a. KMT3F, KMT3G, MMSET, RAUST, REIIBP, TRX5, WHS, WHSC1)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACATGGTCCTGCTGGAGTTCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The L237R mutation in ECFP did not affect expression of the fusion protein, fluorescence and binding of a GFP antibody, and is therefore not of relevance for the experiments conducted in the publication.
DNA (Catalog # 221382-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 221382-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECFP_C1_NSD2 FL was a gift from Albert Jeltsch (Addgene plasmid # 221382 ; http://n2t.net/addgene:221382 ; RRID:Addgene_221382) -
For your References section:
Discovery of NSD2 non-histone substrates and design of a super-substrate. Weirich S, Kusevic D, Schnee P, Reiter J, Pleiss J, Jeltsch A. Commun Biol. 2024 Jun 8;7(1):707. doi: 10.1038/s42003-024-06395-z. 10.1038/s42003-024-06395-z PubMed 38851815