TL1 alphaL_DdCBE 3-4 (left, DddA11-C) - TL1 alphaDdCBE 1 (left, DddA11-C)
(Plasmid
#221998)
-
PurposeExpresses mitochondrial cytosine base editor arm in mammalian cells
-
Depositing Lab
-
Depositing OrganizationMayo Foundation for Medical Education and Research
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 221998-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 221998-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4717
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCOX8A MTS-3xFLAG-TALE NT-alphaN-TL1 TALE repeats (alphaL-3/4 left, alpha-1 left)-TALE CTD-DddA6/11 1397C-UGI-ATP5B 3'UTR
-
SpeciesSynthetic
-
Insert Size (bp)2797
-
MutationTALE: Q231R, W232G, S233A | DddA: T1413I
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer T7
- 3′ sequencing primer ACACCCGCCGCGCTTAATGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' Cloning Site: BsmBI (Not Destroyed), 3' Cloning Site: BsmBI (Not Destroyed). Please visit https://www.biorxiv.org/content/10.1101/2024.05.13.593977v1 for bioRxiv preprint.
DNA (Catalog # 221998-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 221998-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TL1 alphaL_DdCBE 3-4 (left, DddA11-C) - TL1 alphaDdCBE 1 (left, DddA11-C) was a gift from Stephen Ekker (Addgene plasmid # 221998 ; http://n2t.net/addgene:221998 ; RRID:Addgene_221998) -
For your References section:
Unconstrained Precision Mitochondrial Genome Editing with alphaDdCBEs. Castillo SR, Simone BW, Clark KJ, Devaux P, Ekker SC. Hum Gene Ther. 2024 Sep 24. doi: 10.1089/hum.2024.073. 10.1089/hum.2024.073 PubMed 39212664
