Skip to main content

PEmax_AAVS1_knockin_HDR_donor
(Plasmid #223000)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223000 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 223000-D50 50 μg of DNA in Tris buffer $495
DNA 223000-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBluescript
  • Total vector size (bp) 15566
  • Vector type
    Mammalian Expression ; HDR donor
  • Selectable markers
    Neomycin (select with G418) ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PEmax
  • Species
    Synthetic; SpCas9 is from Streptococcus pyogenes; MMLV_RT is from the Moloney murine leukemia virus
  • Insert Size (bp)
    6393
  • Promoter EF1α
  • Tags / Fusion Proteins
    • SV40 bpNLS (N terminal on insert)
    • SV40 bpNLS (C terminal on insert)
    • c-Myc NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BstXI (not destroyed)
  • 5′ sequencing primer CGAAAGCAGCGAGACAGG
  • 3′ sequencing primer TGGCTCTCCTCAAGCGTATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PEmax_AAVS1_knockin_HDR_donor was a gift from Brittany Adamson (Addgene plasmid # 223000 ; http://n2t.net/addgene:223000 ; RRID:Addgene_223000)
  • For your References section:

    Improving prime editing with an endogenous small RNA-binding protein. Yan J, Oyler-Castrillo P, Ravisankar P, Ward CC, Levesque S, Jing Y, Simpson D, Zhao A, Li H, Yan W, Goudy L, Schmidt R, Solley SC, Gilbert LA, Chan MM, Bauer DE, Marson A, Parsons LR, Adamson B. Nature. 2024 Apr 3. doi: 10.1038/s41586-024-07259-6. 10.1038/s41586-024-07259-6 PubMed 38570691