Skip to main content

pC0043-PspCas13b-gRNA LINE1
(Plasmid #223699)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223699 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 223699-D50 50 μg of DNA in Tris buffer $495
DNA 223699-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pC0043
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA target sequence for LINE1
  • gRNA/shRNA sequence
    CAGATACCAGGTACCAAAGTT
  • Species
    M. musculus (mouse)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC0043-PspCas13b-gRNA LINE1 was a gift from Chuan He (Addgene plasmid # 223699 ; http://n2t.net/addgene:223699 ; RRID:Addgene_223699)
  • For your References section:

    FTO mediates LINE1 m(6)A demethylation and chromatin regulation in mESCs and mouse development. Wei J, Yu X, Yang L, Liu X, Gao B, Huang B, Dou X, Liu J, Zou Z, Cui XL, Zhang LS, Zhao X, Liu Q, He PC, Sepich-Poore C, Zhong N, Liu W, Li Y, Kou X, Zhao Y, Wu Y, Cheng X, Chen C, An Y, Dong X, Wang H, Shu Q, Hao Z, Duan T, He YY, Li X, Gao S, Gao Y, He C. Science. 2022 May 27;376(6596):968-973. doi: 10.1126/science.abe9582. Epub 2022 May 5. 10.1126/science.abe9582 PubMed 35511947