pIRES2-eGFP:HA-mTREK-1
(Plasmid
#224773)
-
PurposeMammalian expression vector for generating mouse TREK-1
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224773 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 224773-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 224773-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES2-eGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePotassium channel subfamily K member 2
-
Alt nameKcnk2
-
Alt nameTREK-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1263
-
Entrez GeneKcnk2 (a.k.a. A430027H14Rik, TREK-1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 224773-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 224773-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES2-eGFP:HA-mTREK-1 was a gift from Dan Minor (Addgene plasmid # 224773 ; http://n2t.net/addgene:224773 ; RRID:Addgene_224773) -
For your References section:
Development of covalent chemogenetic K(2P) channel activators. Deal PE, Lee H, Mondal A, Lolicato M, Mendonca PRF, Black H, Jang S, El-Hilali X, Bryant C, Isacoff EY, Renslo AR, Minor DL Jr. Cell Chem Biol. 2024 Jul 18;31(7):1305-1323.e9. doi: 10.1016/j.chembiol.2024.06.006. 10.1016/j.chembiol.2024.06.006 PubMed 39029456
