Skip to main content

pRSET OCaMP
(Plasmid #224932)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224932 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pRSET
  • Total vector size (bp) 5679
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OCaMP
  • Alt name
    Orange calcium indicator
  • Alt name
    OGECI
  • Species
    Synthetic; Bacteria (E.coli)
  • Insert Size (bp)
    1342
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • Xpress tag (N terminal on backbone)
    • RSET peptide (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer tagggagaccacaacggtttccctctagaaataattttgtttaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.07.28.667269 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSET OCaMP was a gift from Alexander Lohman (Addgene plasmid # 224932 ; http://n2t.net/addgene:224932 ; RRID:Addgene_224932)
  • For your References section:

    A sensitive orange fluorescent calcium ion indicator for imaging neural activity. Aggarwal A, Baker HA, Durst CD, Chen IW, de Chambrier P, Stine C, Gonzales JM, Marvin JS, Vandal M, Lundberg T, Brown-Panton CA, Sakoi K, Patel R, Wang CY, Visser F, Fouad Y, Sunil S, Wiens M, Terai T, Takahashi-Yamashiro K, Thompson RJ, Brown TA, Nasu Y, Nguyen MD, Gordon GRJ, McFarlane S, Podgorski K, Holtmaat A, Campbell RE, Lohman AW. Nat Commun. 2026 Jun 22. doi: 10.1038/s41467-026-74553-4. 10.1038/s41467-026-74553-4 PubMed 42331843