Skip to main content
Addgene
Open Menu

pEF2-FL-hMer_gR1
(Plasmid #225993)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225993 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 225993-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 225993-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEF2
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human MerTK N-Terminal human Interferon Gamma R1 Receptor C-Terminal fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2271
  • Entrez Gene
    MERTK (a.k.a. MER, RP38, Tyro12, c-Eyk, c-mer)
  • Entrez Gene
    IFNGR1 (a.k.a. CD119, IFNGR, IMD27A, IMD27B)
  • Promoter EF1-a

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcttccatttcaggtgtcg
  • 3′ sequencing primer gtcgaggctgatcagcgagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF2-FL-hMer_gR1 was a gift from Raymond Birge & Sergei Kotenko (Addgene plasmid # 225993 ; http://n2t.net/addgene:225993 ; RRID:Addgene_225993)

  • For your References section:

    Receptor tyrosine kinases, TYRO3, AXL, and MER, demonstrate distinct patterns and complex regulation of ligand-induced activation. Tsou WI, Nguyen KQ, Calarese DA, Garforth SJ, Antes AL, Smirnov SV, Almo SC, Birge RB, Kotenko SV. J Biol Chem. 2014 Sep 12;289(37):25750-63. doi: 10.1074/jbc.M114.569020. Epub 2014 Jul 29. 10.1074/jbc.M114.569020 PubMed 25074926
Related items: