pCKC764
(Plasmid
#226625)
-
PurposepiggyBAC pCAG-hCas9-T2A-Unbiased3
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Irvine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 226625-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 226625-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMTK0_002 piggyBAC destination vector (Addgene plasmid #123960)
- Backbone size w/o insert (bp) 2502
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCAG promoter, SpCas9, T2A, Unbiased3 variant of TdT
-
SpeciesH. sapiens (human), G. gallus (chicken); S. pyogenes
-
Insert Size (bp)7591
-
Entrez GeneDNTT (a.k.a. TDT)
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Golden Gate
- 5′ sequencing primer agaatgctagcatgggcccagatc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEF1a promoter, blasticidin resistance
- Promoter EF1a
Cloning Information for Gene/Insert 2
- Cloning method Golden Gate
- 5′ sequencing primer gaaggaaaggttgcatgctggacac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has also been grown in Invitrogen TOP10 chemically competent E. coli.
Please visit https://doi.org/10.1101/2024.06.11.598561 for bioRxiv preprint.
DNA (Catalog # 226625-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 226625-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCKC764 was a gift from Chang Liu (Addgene plasmid # 226625 ; http://n2t.net/addgene:226625 ; RRID:Addgene_226625) -
For your References section:
A massively parallel in vivo assay of TdT mutants yields variants with altered nucleotide insertion biases. Carlson CK, Loveless TB, Milisavljevic M, Kelly PI, Mills JH, Tyo KEJ, Liu CC. bioRxiv [Preprint]. 2024 Jun 11:2024.06.11.598561. doi: 10.1101/2024.06.11.598561. 10.1101/2024.06.11.598561 PubMed 38915690