qTAG-N-Solo-mStayGold-TUBA1B
(Plasmid
#227327)
-
PurposeDonor template for mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)
-
Depositing Lab
-
Depositing OrganizationSinai Health System
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 227327-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 227327-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2686
-
Vector typeMammalian Expression, CRISPR ; Donor Template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUBA1B Homology Arms flanking a mStayGold Tag
-
Alt nameTUBA1B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1869
-
Entrez GeneTUBA1B (a.k.a. K-ALPHA-1)
- Promoter Promoterless
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCAAGGCGATTAAGTTGGGTAAC
- 3′ sequencing primer GGCTCGTATGTTGTGTGGAATTGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763): https://www.addgene.org/207763/
DNA (Catalog # 227327-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 227327-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
qTAG-N-Solo-mStayGold-TUBA1B was a gift from Laurence Pelletier (Addgene plasmid # 227327 ; http://n2t.net/addgene:227327 ; RRID:Addgene_227327) -
For your References section:
qTAG: an adaptable plasmid scaffold for CRISPR-based endogenous tagging. Philip R, Sharma A, Matellan L, Erpf AC, Hsu WH, Tkach JM, Wyatt HDM, Pelletier L. EMBO J. 2024 Dec 12. doi: 10.1038/s44318-024-00337-5. 10.1038/s44318-024-00337-5 PubMed 39668248