AAV-NG-CBE C
(Plasmid
#227422)
-
Purposeexpresses the C-terminal of AAV-NG-CBE
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepx601
- Total vector size (bp) 7654
-
Modifications to backboneBackbone sourced from Addgene plasmid #137176
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV-NG-CBE C-terminal
-
SpeciesSynthetic
- Promoter Cbh
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaagaggtaagggtttaaggg
- 3′ sequencing primer U6
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDavid Liu, backbone sourced from Addgene plasmid #137176.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-NG-CBE C was a gift from Yang Sun (Addgene plasmid # 227422 ; http://n2t.net/addgene:227422 ; RRID:Addgene_227422) -
For your References section:
Efficient Rescue of Retinal Degeneration in Pde6a Mice by Engineered Base Editing and Prime Editing. Liu Z, Chen S, Davis AE, Lo CH, Wang Q, Li T, Ning K, Zhang Q, Zhao J, Wang S, Sun Y. Adv Sci (Weinh). 2024 Sep 19:e2405628. doi: 10.1002/advs.202405628. 10.1002/advs.202405628 PubMed 39297417