pHPHS232
(Plasmid
#228356)
-
PurposeLanding pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locus
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAVS1P-iCAG.copGFP
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418), Blasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemTagBFP2
-
SpeciesSynthetic
- Promoter TRE3GV
-
Tags
/ Fusion Proteins
- iCasp9
- Blasticidin S deaminase
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagtagccaggatgtc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameReverse tetracycline transactivator 3
-
Alt namertTA3
-
SpeciesSynthetic
- Promoter TRE3GV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGAATCAGCATCGCTCATACTATATGGGGTAGGTGGGCCGGCCTT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameneo
-
SpeciesSynthetic
- Promoter gene trap
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgacctcttctcttcctcccacagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.07.25.605204 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHPHS232 was a gift from Arvind Rasi Subramaniam (Addgene plasmid # 228356 ; http://n2t.net/addgene:228356 ; RRID:Addgene_228356) -
For your References section:
Decoding post-transcriptional regulatory networks by RNA-linked CRISPR screening in human cells. Nugent PJ, Park H, Wladyka CL, Yelland JN, Sinha S, Chen KY, Bynum C, Quarterman G, Lee SC, Hsieh AC, Subramaniam AR. Nat Methods. 2025 Jun;22(6):1237-1246. doi: 10.1038/s41592-025-02702-6. Epub 2025 May 29. 10.1038/s41592-025-02702-6 PubMed 40442371