AP1muA single guide RNA
(Plasmid
#230030)
-
Purposeguide RNA for AP1muA tagging at the C-terminus in pX459
-
Depositing Lab
-
Depositing OrganizationFreie Universitaet Berlin
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 230030-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 230030-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX459
-
Backbone manufacturerFeng Zhang, Addgene plasmid #62988
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAP1M1 guide
-
gRNA/shRNA sequenceCAGCCAACACCCCGGCCTCG
-
SpeciesH. sapiens (human)
-
Entrez GeneAP1M1 (a.k.a. AP47, CLAPM2, CLTNM, MU-1A, mu1A)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 230030-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 230030-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AP1muA single guide RNA was a gift from Francesca Bottanelli (Addgene plasmid # 230030 ; http://n2t.net/addgene:230030 ; RRID:Addgene_230030) -
For your References section:
When less is more - a fast TurboID knock-in approach for high-sensitivity endogenous interactome mapping. Stockhammer A, Spalt C, Klemt A, Benz LS, Harel S, Natalia V, Wiench L, Freund C, Kuropka B, Bottanelli F. J Cell Sci. 2024 Aug 15;137(16):jcs261952. doi: 10.1242/jcs.261952. Epub 2024 Aug 28. 10.1242/jcs.261952 PubMed 39056144