fabp10a:DD-CreER; cryaa:mCerulean
(Plasmid
#230076)
-
PurposeExpression of destabilized CreER in zebrafish hepatocytes.
-
Depositing Lab
-
Depositing OrganizationUniversite Libre de Bruxelles
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBlueScript
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameltDHFR(DD)
-
Alt namefolA dihydrofolate reductase ( destable domain) for low temperature (zebrafish codon optimized)
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)2568
-
Mutationamino acids mutations: R12H, N23S, G67S, V78A, E120G, E134G, E153V, E157G
-
GenBank IDAAC73159
- Promoter fabp10a
-
Tags
/ Fusion Proteins
- CreER (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtcgtcaaatcctggtgcaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThomas Wandless. Sequence for DD was obtained from pBMN ltDHFR(DD)-YFP (Addgene Plasmid #47076), which is mutant #21 published in Cho et al., PLoS One. 2013 Aug 22;8(8):e72393. doi: 10.1371/journal.pone.0072393. We utilized this sequence and generated a zebrafish codon optimized version. This sequence was synthesized, along with CreER to give a DD-CreER sequence.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.23.655316 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fabp10a:DD-CreER; cryaa:mCerulean was a gift from Sumeet Pal Singh (Addgene plasmid # 230076 ; http://n2t.net/addgene:230076 ; RRID:Addgene_230076) -
For your References section:
CellCousin2: an optimized system for partial ablation and tracing of regenerative lineages. Hovhannisyan GG, Akhourbi T, Eski SE, Pirson I, Gurzov EN, Singh SP. NPJ Regen Med. 2026 Mar 30. doi: 10.1038/s41536-026-00473-y. 10.1038/s41536-026-00473-y PubMed 41912583