fabp10a:ER-CreER; cryaa:mCerulean
(Plasmid
#230077)
-
PurposeExpression of ERCreER in zebrafish hepatocytes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBlueScript
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERT2-Cre-ERT2
-
SpeciesBacteriophage P1
-
Insert Size (bp)2951
- Promoter fabp10a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtcgtcaaatcctggtgcaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.23.655316 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fabp10a:ER-CreER; cryaa:mCerulean was a gift from Sumeet Pal Singh (Addgene plasmid # 230077 ; http://n2t.net/addgene:230077 ; RRID:Addgene_230077) -
For your References section:
CellCousin2: An Optimized System for Partial Ablation and Tracing of Regenerative Lineages. Hovhannisyan GG, Akhourbi T, Eski SE, Pirson I, Gurzov EN, Singh SP. bioRxiv 2025.05.23.655316 10.1101/2025.05.23.655316