pcDNA3.1-HA-RAD52-WT
(Plasmid
#235676)
-
PurposeExpresses HA-tagged wild type human RAD52 in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 235676-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 235676-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1(+)-N-HA
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAD52
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1269
-
Mutationwild type
-
GenBank IDNM_134424.4
-
Entrez GeneRAD52
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 235676-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 235676-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-HA-RAD52-WT was a gift from Simon Powell (Addgene plasmid # 235676 ; http://n2t.net/addgene:235676 ; RRID:Addgene_235676) -
For your References section:
RAD52 resolves transcription-replication conflicts to mitigate R-loop induced genome instability. Jalan M, Sharma A, Pei X, Weinhold N, Buechelmaier ES, Zhu Y, Ahmed-Seghir S, Ratnakumar A, Di Bona M, McDermott N, Gomez-Aguilar J, Anderson KS, Ng CKY, Selenica P, Bakhoum SF, Reis-Filho JS, Riaz N, Powell SN. Nat Commun. 2024 Sep 5;15(1):7776. doi: 10.1038/s41467-024-51784-x. 10.1038/s41467-024-51784-x PubMed 39237529