Skip to main content

pLEX-VSV-G-Foldon-Intein-Cas9
(Plasmid #247731)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 247731 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLEX
  • Backbone size w/o insert (bp) 4521
  • Total vector size (bp) 10971
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSV-G-Foldon-Intein-Cas9
  • Alt name
    VFIC Cas9 plasmid
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6450
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAA
  • 3′ sequencing primer GGGCATTGGCCACACCAGCCACCACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX-VSV-G-Foldon-Intein-Cas9 was a gift from Samir El Andaloussi (Addgene plasmid # 247731 ; http://n2t.net/addgene:247731 ; RRID:Addgene_247731)
  • For your References section:

    Engineering of extracellular vesicles for efficient intracellular delivery of multimodal therapeutics including genome editors. Liang X, Gupta D, Xie J, Van Wonterghem E, Van Hoecke L, Hean J, Niu Z, Ghaeidamini M, Wiklander OPB, Zheng W, Wiklander RJ, He R, Mamand DR, Bost J, Zhou G, Zhou H, Roudi S, Estupinan HY, Radler J, Zickler AM, Gorgens A, Hou VWQ, Slovak R, Hagey DW, de Jong OG, Uy AG, Zong Y, Mager I, Perez CM, Roberts TC, Carter D, Vader P, Esbjorner EK, de Fougerolles A, Wood MJA, Vandenbroucke RE, Nordin JZ, El Andaloussi S. Nat Commun. 2025 Apr 29;16(1):4028. doi: 10.1038/s41467-025-59377-y. 10.1038/s41467-025-59377-y PubMed 40301355