Skip to main content
Addgene
Open Menu

pmCherry-SC35 (pc3332)
(Plasmid #235782)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235782 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pmCherry-C1
  • Total vector size (bp) 5369
  • Modifications to backbone
    Mammalian expression plasmid encoding mCherry-SC35 (pc3332) was generated by cutting the SC35 coding sequence (CDS) from thevector pEYFP-SC35 (pc1202) and cloning it into the pmCherry-C1 backbone (pc2387) using restriction enzymes BspE1 and HindIII.
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SC35
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    663
  • Entrez Gene
    SRSF2 (a.k.a. PR264, SC-35, SC35, SFRS2, SFRS2A, SRp30b)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspE1 (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer GCATGGACGAGCTGTACAAG
  • 3′ sequencing primer TTCAGCTTGGCGGTCTGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.03.07.641893 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-SC35 (pc3332) was a gift from Cristina Cardoso (Addgene plasmid # 235782 ; http://n2t.net/addgene:235782 ; RRID:Addgene_235782)

  • For your References section:

    TET dioxygenases localize at splicing speckles and promote RNA splicing. Hastert FD, Weber J, Bauer C, Zhadan A, Singh DND, Dix TC, Arnold R, Bessonov S, Soller M, Leonhardt H, Cardoso MC, Arroyo M. Nucleus. 2025 Dec;16(1):2536902. doi: 10.1080/19491034.2025.2536902. Epub 2025 Jul 27. 10.1080/19491034.2025.2536902 PubMed 40717330
Related items: