Skip to main content
Addgene
Open Menu

phnRNP-DL-EGFP_ECFP-NMD (pc3351)
(Plasmid #235783)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235783 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pWHE200 (pc3335)
  • Total vector size (bp) 7460
  • Modifications to backbone
    To generate the splicing reporter vector phnRNP-DL-EGFP_ECFP(pc3351), the firefly luciferase sequence was cut from the vector pWHE200 (pc3335) using BamHI and NotI restriction enzymes. The ECFP reverse complement CDS was amplified from pc0911 using the following primers: forward 5’-gagtactgcagttacttgtacagc-3,“ reverse 5”-gagtagaattcatggtgagcaagg-3.’ The Renilla luciferase sequence was then replaced using PstI and EcoRI restriction.
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ECFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    717
  • GenBank ID
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer gagtagaattcatggtgagcaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.03.07.641893 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phnRNP-DL-EGFP_ECFP-NMD (pc3351) was a gift from Cristina Cardoso (Addgene plasmid # 235783 ; http://n2t.net/addgene:235783 ; RRID:Addgene_235783)

  • For your References section:

    TET dioxygenases localize at splicing speckles and promote RNA splicing. Hastert FD, Weber J, Bauer C, Zhadan A, Singh DND, Dix TC, Arnold R, Bessonov S, Soller M, Leonhardt H, Cardoso MC, Arroyo M. Nucleus. 2025 Dec;16(1):2536902. doi: 10.1080/19491034.2025.2536902. Epub 2025 Jul 27. 10.1080/19491034.2025.2536902 PubMed 40717330
Related items: