PB-U6-CNCB_sgEIF3D-4
(Plasmid
#236766)
-
PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.
-
Depositing Lab
-
Depositing OrganizationKyoto University, Center for iPS Cell Research and Application
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 236766-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 236766-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePB-U6-CNCB
-
Backbone manufacturerSynthetic
- Backbone size w/o insert (bp) 8339
- Total vector size (bp) 8342
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEIF3D sgRNA-4
-
gRNA/shRNA sequenceCTGCTGCTAACGCGGTCCC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003753.4
-
Entrez GeneEIF3D (a.k.a. EIF3S7, eIF3-p66, eIF3-zeta)
- Promoter mouse U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer GAGGCTTAATGTGCGATAAAAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 236766-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 236766-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-U6-CNCB_sgEIF3D-4 was a gift from Kazutoshi Takahashi (Addgene plasmid # 236766 ; http://n2t.net/addgene:236766 ; RRID:Addgene_236766) -
For your References section:
EIF3D safeguards the homeostasis of key signaling pathways in human primed pluripotency. Okubo C, Nakamura M, Sato M, Shichino Y, Mito M, Takashima Y, Iwasaki S, Takahashi K. Sci Adv. 2025 Apr 11;11(15):eadq5484. doi: 10.1126/sciadv.adq5484. Epub 2025 Apr 9. 10.1126/sciadv.adq5484 PubMed 40203091
