pGP-pcDNA3.1 Puro-CAG-Positron2
(Plasmid
#239079)
-
PurposeMammalian expression of positive-going voltage sensor
-
Depositing Lab
-
Depositing OrganizationHHMI, Janelia Research Campus
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 239079-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 239079-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePositron2
-
Alt namePositron2 insert
-
Alt namevariant 421.6237
-
SpeciesSynthetic
-
Insert Size (bp)1659
-
MutationR78K N81D D92N W178F
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TTAAAGCAGCGTATCCACAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 239079-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 239079-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-pcDNA3.1 Puro-CAG-Positron2 was a gift from GENIE Project (Addgene plasmid # 239079 ; http://n2t.net/addgene:239079 ; RRID:Addgene_239079) -
For your References section:
Optimization of Ace2N based voltage indicators. Eric R. Schreiter, Ahmed Abdelfattah, Jeremy Hasseman, Daniel Reep, Getahun Tsegaye, Arthur Tsang, Ilya Kolb, Allan Wong, Amy Chuong, Jihong Zheng, Ben Arthur, Wyatt Korff, GENIE Project Team. Janelia Figshare 2023 10.25378/janelia.22325446.v1