pAAV-EF1a-DIO-DSE-mCherry-PSE-shVglut1
(Plasmid #240412)

• Purpose: Cre-dependent expression of Vglut1 shRNA, shVglut1-expressing cells are labeled with mCherry
• Depositing Lab: Oscar Marin
• Depositing Organization: King's College London
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Moissidis et al Cell. 2025 Oct 2;188(20):5555-5575.e26. doi: 10.1016/j.cell.2025.06.029. Epub 2025 Jul 15.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Total vector size (bp): 6808
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: shVglut1-mCherry
• Alt name: Slc17a7
• gRNA/shRNA sequence: CGCCTAACCAATTCTACATTT
• Species: M. musculus (mouse)
• Entrez Gene: Slc17a7 (a.k.a. 2900052E22Rik, Vglut1)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry