Skip to main content
Addgene
Open Menu

LAMP1-G-GECO1.2
(Plasmid #240467)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240467 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 240467-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 240467-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pDendra2-N
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3964
  • Total vector size (bp) 6508
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LAMP1
  • Alt name
    Lysosome associated membrane protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1251
  • Mutation
    Silent mutation
  • GenBank ID
    3916
  • Entrez Gene
    LAMP1 (a.k.a. CD107a, LAMPA, LGP120)
  • Promoter CMV
  • Tag / Fusion Protein
    • G-GECO1.2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAA CGG GAC TTT CCA AAA TG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LAMP1-G-GECO1.2 was a gift from Antony Galione (Addgene plasmid # 240467 ; http://n2t.net/addgene:240467 ; RRID:Addgene_240467)

  • For your References section:

    Optical profiling of autonomous Ca(2+) nanodomains generated by lysosomal TPC2 and TRPML1. Davis LC, Morgan AJ, Galione A. Cell Calcium. 2023 Dec;116:102801. doi: 10.1016/j.ceca.2023.102801. Epub 2023 Sep 18. 10.1016/j.ceca.2023.102801 PubMed 37742482
Related items:
Commonly requested with: