AAV Syn-FLEX-coca-5HT3-IRES-mCherry
(Plasmid
#242195)
-
PurposeCre-dependent AAV vector for cocaine-gated chemogenetic cation channel
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAV Syn FLEX rev IRES mcherry
- Backbone size w/o insert (bp) 5464
- Total vector size (bp) 7615
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSyn-FLEX-coca-5HT3-IRES-mCherry
-
Alt nameHtr3a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2151
-
MutationL141G G175K Y210F Y217F
-
Entrez GeneHtr3a (a.k.a. 5-HT3, 5-HT3A, 5-HT3R)
- Promoter Synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtaagtatcaaggttacaag
- 3′ sequencing primer ctgacaacgggccacaactc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV Syn-FLEX-coca-5HT3-IRES-mCherry was a gift from Scott Sternson (Addgene plasmid # 242195 ; http://n2t.net/addgene:242195 ; RRID:Addgene_242195) -
For your References section:
Cocaine chemogenetics blunts drug-seeking by synthetic physiology. Gomez JL, Magnus CJ, Bonaventura J, Solis O, Curry FP, Levinstein MR, Budinich RC, Carlton ML, Ventriglia EN, Lam S, Wang L, Schoenborn I, Dunne W, Michaelides M, Sternson SM. Nature. 2025 Aug 27. doi: 10.1038/s41586-025-09427-8. 10.1038/s41586-025-09427-8 PubMed 40866713