Skip to main content

pAG mKappa Empty
(Plasmid #242954)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 242954 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pAG AB
  • Backbone manufacturer
    Addgene
  • Backbone size (bp) 4244
  • Vector type
    Mammalian Expression
  • Promoter CMV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgggctgatgctgcaccaac
  • 3′ sequencing primer ggccctcgaggacgccagca
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid 242954 pAG mKappa Empty encodes the mouse kappa light chain constant region and a filler sequence in lieu of a light chain variable region. To clone in your desired light chain variable region in frame with the mouse kappa light chain constant region, Addgene recommends the NEB Hifi assembly method.

PCR Amplify the backbone from plasmid 242954 pAG mKappa Empty with the following primers: 5’-cgggctgatgctgcaccaac and 5’-ggccctcgaggacgccagca.

Synthesize a gene fragment of the desired light chain variable region with flanking sequences that overlap with the backbone PCR product 5’-tgctggcgtcctcgagggcc-Gene fragment-cgggctgatgctgcaccaac

Assemble with the NEB HiFI assembly (NEB #E2621S) following the manufacturer’s recommendations

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG mKappa Empty was a gift from Meghan Rego & Addgene Research Program (Addgene plasmid # 242954 ; http://n2t.net/addgene:242954 ; RRID:Addgene_242954)