-
Depositing Labs
-
Depositing OrganizationNational Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS)
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 24520-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 24520-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepECFPC1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameECFP, EYFP
-
Alt nameCFP,YFP
-
SpeciesVibrio fischeri
-
Insert Size (bp)757
-
GenBank IDP21578
-
Tags
/ Fusion Proteins
- ECFP (C terminal on backbone)
- EYFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsp E1 (unknown if destroyed)
- 3′ cloning site Bgl II (unknown if destroyed)
- 5′ sequencing primer AAGTCCGGAATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer TCAAGATCTCTTGTACAGCTCGTCCATGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 24520-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 24520-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-ECFPEYFP was a gift from Liusheng He & Jehonathan Pinthus (Addgene plasmid # 24520 ; http://n2t.net/addgene:24520 ; RRID:Addgene_24520) -
For your References section:
A flow cytometric method to detect protein-protein interaction in living cells by directly visualizing donor fluorophore quenching during CFP-->YFP fluorescence resonance energy transfer (FRET). He L, Olson DP, Wu X, Karpova TS, McNally JG, Lipsky PE. Cytometry A. 2003 Oct . 55(2):71-85. 10.1002/cyto.a.10073 PubMed 14505312