pFloxin-Ofd1-Myc-S437R
(Plasmid #24577)

• Depositing Lab: Jeremy Reiter
• Publication: Singla et al Dev Cell. 2010 Mar 16. 18(3):410-24.

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 4021
• Vector type: Mouse Targeting, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Growth instructions: Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ofd1
• Species: M. musculus (mouse)
• Insert Size (bp): 2781
• Mutation: Serine 437 changed to Arginine (codon AGT to CGT) Includes exons 4-23 only
• GenBank ID: NM_177429
• Entrez Gene: Ofd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: aacctctgccctttctcctc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation reported in:

Identification of the gene for oral-facial-digital type I syndrome.

Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Sylvie O, Bernard L, Malcolm S, Winter R, Ballabio A, Franco B.

Am J Hum Genet. 2001 Mar;68(3):569-76. Epub 2001 Feb 13.PMID: 11179005