huCof null + rat cof shRNA
(Plasmid #245960)

• Purpose: Silencing of endogenous cofilin in rat/mouse cells with replacement by an inactive human cofilin expressed with a cofilin promoter (control for plasmid listed above)
• Depositing Lab: James Bamburg
• Depositing Organization: Colorado State University, Fort Collins
  Located in the United States of America
• Publication: Bamburg lab plasmids 2025 (unpublished)

Backbone

• Vector backbone: pShuttle MCP
• Backbone size w/o insert (bp): 8507
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cofilin 1 (cfl1)
• gRNA/shRNA sequence: AAGGTGTTCAATGACATGAAA
• Species: H. sapiens (human)
• Mutation: _1-5, Y82F, KK95,96QQ
• Entrez Gene: CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
• Promoter: MCP for cofilin and pol III for shRNA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unspecified (unknown if destroyed)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

DNA (Catalog # 245960-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 245960-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.