Skip to main content
Addgene
Open Menu

huCof null + rat cof shRNA
(Plasmid #245960)

Print
  • Purpose
    Silencing of endogenous cofilin in rat/mouse cells with replacement by an inactive human cofilin expressed with a cofilin promoter (control for plasmid listed above)
  • Depositing Lab
    James Bamburg
  • Depositing Organization
    Colorado State University, Fort Collins
    Located in the United States of America
  • Publication
    Bamburg lab plasmids 2025 (unpublished) ( How to cite )
  • Sequence Information

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 245960 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pShuttle MCP
  • Backbone size w/o insert (bp) 8507
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1 (cfl1)
  • gRNA/shRNA sequence
    AAGGTGTTCAATGACATGAAA
  • Species
    H. sapiens (human)
  • Mutation
    _1-5, Y82F, KK95,96QQ
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter MCP for cofilin and pol III for shRNA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    huCof null + rat cof shRNA was a gift from James Bamburg (Addgene plasmid # 245960 ; http://n2t.net/addgene:245960 ; RRID:Addgene_245960)
Related items: