NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide
(Plasmid #246438)

• Purpose: All-in-one plasmid. Expresses R-NmeCas9 in mammalian cells for RNA knockdown. Spacer targeting EZH2 gene.
• Depositing Lab: Ailong Ke
• Depositing Organization: Yale University
  Located in the United States of America
• Publication: Xu et al Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032.

Backbone

• Vector backbone: pSimpleII
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: NmeCas9
• Species: Neisseria meningitidis, strain 8013
• Insert Size (bp): 2931
• Mutation: changed Aspartic acid 16 to Alanine, deleted amino acids 951-1059
• GenBank ID: FM999788.1 19818133
• Promoter: EF-1 alpha
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • HA tag (C terminal on insert)
  • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gctgccttcaaacctaattcaatcaactacatcctc
• 3′ sequencing primer: acggacaggcgggcgttttttca

Gene/Insert 2

• Gene/Insert name: Nme-sgRNA
• Species: Neisseria meningitidis, strain 8013
• Insert Size (bp): 156
• Mutation: fusion of repeat/tracrRNA to make a sgRNA
• GenBank ID: FM999788.1
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagcagatactggcttaactatg
• 3′ sequencing primer: aaataaacaaataggggttccgc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 246438-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 246438-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.