Skip to main content

pTol2-HuC(elavl3)-JEDI3sub
(Plasmid #246621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246621 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTol2
  • Backbone size w/o insert (bp) 12562
  • Vector type
    Zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JEDI3sub
  • Species
    Synthetic
  • Insert Size (bp)
    1281
  • Promoter HuC(elavl3)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GTGGGATATTGTCCTCCTCAG
  • 3′ sequencing primer ACAAATAAAGCAATAGCATCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was not directly tested in the corresponding publication, but the plasmid does contain the GEVI characterized in the corresponding publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-HuC(elavl3)-JEDI3sub was a gift from Francois St-Pierre (Addgene plasmid # 246621 ; http://n2t.net/addgene:246621 ; RRID:Addgene_246621)
  • For your References section:

    Designer indicators for two-photon recording of subthreshold voltage dynamics. Land MA, Galdamez M, Villette V, Zhu J, Lu X, Marosi M, Yang S, Foran G, McDonald AJ, Dong X, Zaabout E, Liu H, Liu Z, Colbert KL, Lai S, Shorey M, Lourdiane ASG, Ayon A, Bradley J, Mailhes-Hamon C, Natan RG, Zhong J, Kroeger R, Law RG, Hakam N, Smith CL, Hu M, Tabb S, Bathellier B, Dudok B, Ji N, Bourdieu L, Reimer J, St-Pierre F. Nat Methods. 2026 Apr 15. doi: 10.1038/s41592-026-03043-8. 10.1038/s41592-026-03043-8 PubMed 41986688